View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-19 (Length: 127)
Name: Solexa-NF5809-19
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-19 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 5e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 6206652 - 6206533
Alignment:
| Q |
8 |
attctcttgtttgaaatattttaacatttctaaatgtaatctgatagagaccttgctgacaccaccattagttcaaggacttcgaaatctggagaaaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6206652 |
attctcttgtttgaaatattttaacatttctaaatgtaatcggatagagaccttgctgacaccaccattagttcaaggacttcaaaatctggagaaaata |
6206553 |
T |
|
| Q |
108 |
tccgtatctcattgtaaatc |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6206552 |
tccgtatctcattgtaaatc |
6206533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 6233070 - 6232951
Alignment:
| Q |
8 |
attctcttgtttgaaatattttaacatttctaaatgtaatctgatagagaccttgctgacaccaccattagttcaaggacttcgaaatctggagaaaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6233070 |
attctcttgtttgaaatattttaacatttctaaatgtaatcggatagagaccttgctgacaccaccattagttcaaggacttcgaaatctggaggaaatg |
6232971 |
T |
|
| Q |
108 |
tccgtatctcattgtaaatc |
127 |
Q |
| |
|
|| |||| |||||||||| |
|
|
| T |
6232970 |
tctgtatgctattgtaaatc |
6232951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University