View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-14 (Length: 151)
Name: Solexa-NF5811-14
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 6 - 151
Target Start/End: Complemental strand, 45252061 - 45251916
Alignment:
| Q |
6 |
agaaacaaagaaatagtggatttttatttatacgacagatttgctcaaatttgattgatttcttgccaattaatttatcagcagaggttcaaaattttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45252061 |
agaaacaaagaaatagtggatttttatttatacgacagatttgctcaaatttgattgatttcttgccaattaatttatcagcagaggttcaaaattttac |
45251962 |
T |
 |
| Q |
106 |
tgacggtcttctgtcagcaaattgaaggtagttttgccagaaagta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45251961 |
tgacggtcttctgtcagcaaattgaaggtagttttgccagaaagta |
45251916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University