View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-15 (Length: 150)
Name: Solexa-NF5811-15
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 7 - 150
Target Start/End: Complemental strand, 12936179 - 12936036
Alignment:
| Q |
7 |
agatgcatagtaaaaggaagtaatagtttgaaatatgaatgagaaagcaagatgtatctagttgatattgctcttgaatgccatcaaagacattcttaca |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12936179 |
agatgcatagtacaaggaagtaatagtttgaaatatgaatgagaaagcaagatgcatctagttgatattgctcttgaatgacatcaaagacattcttaca |
12936080 |
T |
|
| Q |
107 |
aattgtatgattcgaaaactaagaacttgatggcaaacagatga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12936079 |
aattgtatgattcgaaaactaagaacttgatggcaaacagatga |
12936036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University