View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-18 (Length: 145)
Name: Solexa-NF5811-18
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 50 - 145
Target Start/End: Complemental strand, 45457849 - 45457754
Alignment:
| Q |
50 |
taggatgaatgaatgaatacaaacaagtatttggaagaataagcgattaagacaatgcttgtgcttgttcaaattctatggacggacggagcatac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45457849 |
taggatgaatgaatgaatacaaacaagtatttggaagaataagcgattaagacaatgcttgtgcttgttcaaattctatggacggacggagcatac |
45457754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University