View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-24 (Length: 139)
Name: Solexa-NF5811-24
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-24 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 16 - 139
Target Start/End: Complemental strand, 47424199 - 47424076
Alignment:
| Q |
16 |
tatcattttatactctatatctcttacatcctttcatgagttattttataactttttatttcgaggactgctatatgtagcgagaactttatcccgaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424199 |
tatcattttatactctatatctcttacatcctttcatgagttattttataactttttatttcgaggactgctatatgtagcgagaactttatcccgaaat |
47424100 |
T |
|
| Q |
116 |
gcccttatacttacttgatcttgc |
139 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47424099 |
gcccttatacttacttgatcttgc |
47424076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University