View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-27 (Length: 138)
Name: Solexa-NF5811-27
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-27 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 6e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 6e-67
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 4498623 - 4498760
Alignment:
| Q |
1 |
gaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4498623 |
gaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttggattt |
4498722 |
T |
|
| Q |
101 |
gcagcagggttttkgggggtttgcattgctattttctt |
138 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4498723 |
gcagcagggttttggggggtttgcattgctactttctt |
4498760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 6e-43
Query Start/End: Original strand, 5 - 138
Target Start/End: Complemental strand, 4329282 - 4329149
Alignment:
| Q |
5 |
aattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcag |
104 |
Q |
| |
|
|||||||| ||| | ||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
4329282 |
aattgtacaaaaatgaaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttggatttgcag |
4329183 |
T |
|
| Q |
105 |
cagggttttkgggggtttgcattgctattttctt |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
4329182 |
cagggttttggggggtttgcattgctattttctt |
4329149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University