View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-31 (Length: 135)
Name: Solexa-NF5811-31
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 27 - 132
Target Start/End: Complemental strand, 5643441 - 5643336
Alignment:
| Q |
27 |
aagtaagaaacatagaatataaaatggtgtgccctacacgtattaatctctctaatttagtttttgttaattagacaaacaatttctgaagaattataag |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||| ||| |||||||||||||||| |
|
|
| T |
5643441 |
aagtaagaaacatagaatataaaatggtgtgtcctacacgtattaatctctctaatttagcatttgttaattagataaaaaatatctgaagaattataag |
5643342 |
T |
 |
| Q |
127 |
ttagtt |
132 |
Q |
| |
|
|||||| |
|
|
| T |
5643341 |
ttagtt |
5643336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University