View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-39 (Length: 127)
Name: Solexa-NF5811-39
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-39 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 4935976 - 4936095
Alignment:
| Q |
7 |
actgggtatgtgtcacctataccaatattcaaaaatgttaagagatcacactttcaactaaaaattgacaaatattgtaagttatgtatattagctataa |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4935976 |
actgggtatgtgtcgcctataccaatattgaaaa-tgttaagagatcacactttcaactaaaaattgactaatattgcaagttatgtatattagctataa |
4936074 |
T |
|
| Q |
107 |
actatagtataaactataaat |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4936075 |
actatagtataaactataaat |
4936095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University