View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-40 (Length: 127)
Name: Solexa-NF5811-40
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-40 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 88 - 127
Target Start/End: Original strand, 43227416 - 43227455
Alignment:
| Q |
88 |
ttccttattttatggatggtggtgtggctagatttgaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43227416 |
ttccttattttatggatggtggtgtggctaggtttgaatt |
43227455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 87 - 125
Target Start/End: Original strand, 24455185 - 24455223
Alignment:
| Q |
87 |
cttccttattttatggatggtggtgtggctagatttgaa |
125 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24455185 |
cttccgtattttatggatggtggtgtggctagatttgaa |
24455223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 90 - 127
Target Start/End: Complemental strand, 1615500 - 1615463
Alignment:
| Q |
90 |
ccttattttatggatggtggtgtggctagatttgaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1615500 |
ccttattttatggatggtggtgtggctaggtttgaatt |
1615463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University