View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-45 (Length: 127)
Name: Solexa-NF5811-45
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 32756293 - 32756416
Alignment:
| Q |
1 |
acataaagttctttccctgatatgtacattatgtcttgctctttaccctgtcatttgtaatcatgacatgtacatttcttgttcatcctttttggtcaat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32756293 |
acataaagttgtttccctgatatgtacattatgtcttgctctttaccctgtcatttgtaatcatgacatgtacatttcttgttcatccttttaggtcaat |
32756392 |
T |
|
| Q |
101 |
acttagaagtggaactgaagaggc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32756393 |
acttagaagtggaactgaagaggc |
32756416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 32766673 - 32766796
Alignment:
| Q |
1 |
acataaagttctttccctgatatgtacattatgtcttgctctttaccctgtcatttgtaatcatgacatgtacatttcttgttcatcctttttggtcaat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32766673 |
acataaagttgtttccctgatatgtacattatgtcttgctctttaccctgtcatttgtaatcatgacatgtacatttcttgttcatccttttaggtcaat |
32766772 |
T |
|
| Q |
101 |
acttagaagtggaactgaagaggc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32766773 |
acttagaagtggaactgaagaggc |
32766796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University