View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-46 (Length: 127)
Name: Solexa-NF5811-46
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-46 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 2 - 127
Target Start/End: Complemental strand, 3010412 - 3010287
Alignment:
| Q |
2 |
aacttggaaactggaacatataggtactagagcaaatctgaattccatcaaattgggttttccatttgtagtaacaataatggcaatgacactatatgtg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3010412 |
aacttggaaactggaacatataggtactagagcagatctgaattccatcaaattgggttttccatttagagtaacaataatggcaatgacactatatgtg |
3010313 |
T |
|
| Q |
102 |
cactaatgttcaaattgctctttagt |
127 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
3010312 |
cactaatgttcacattgctctttagt |
3010287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 56 - 125
Target Start/End: Complemental strand, 3019131 - 3019063
Alignment:
| Q |
56 |
gggttttccatttgtagtaacaataatggcaatgacactatatgtgcactaatgttcaaattgctcttta |
125 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| | ||| ||||| || ||||| ||||||||||| |
|
|
| T |
3019131 |
gggtttttcatttggagtaacaataatggcaatgaca-tttatatgcaccaacgttcacattgctcttta |
3019063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University