View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5811-50 (Length: 127)

Name: Solexa-NF5811-50
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5811-50
Solexa-NF5811-50
[»] chr3 (3 HSPs)
chr3 (7-127)||(33093284-33093404)
chr3 (11-87)||(33708375-33708451)
chr3 (21-87)||(33714251-33714317)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 33093284 - 33093404
Alignment:
7 accaagagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtcactttcatgtgttactgat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33093284 accaagagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtcactttcatgtgttactgat 33093383  T
107 gatatgcttatatgtgtagca 127  Q
    ||||||||||| | |||||||    
33093384 gatatgcttatctctgtagca 33093404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 33708375 - 33708451
Alignment:
11 agagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtc 87  Q
    ||||||||  ||||||||||||| | |||||||||||| ||| |||||||||| | ||||||   ||||||||||||    
33708375 agagaaagagaaaatgttacttcgtgcttcattgattcattgatgagtttgaagcgcttaacttgtcttgatttgtc 33708451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 33714251 - 33714317
Alignment:
21 aaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtc 87  Q
    ||||||||||||  |||||||||||||| ||||||||||| || | ||||||   ||||||||||||    
33714251 aaaatgttactttgtacttcattgattcattggtgagtttaaagcgcttaacttgtcttgatttgtc 33714317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University