View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-50 (Length: 127)
Name: Solexa-NF5811-50
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-50 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 33093284 - 33093404
Alignment:
| Q |
7 |
accaagagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtcactttcatgtgttactgat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33093284 |
accaagagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtcactttcatgtgttactgat |
33093383 |
T |
|
| Q |
107 |
gatatgcttatatgtgtagca |
127 |
Q |
| |
|
||||||||||| | ||||||| |
|
|
| T |
33093384 |
gatatgcttatctctgtagca |
33093404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 33708375 - 33708451
Alignment:
| Q |
11 |
agagaaagcaaaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtc |
87 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||| ||| |||||||||| | |||||| |||||||||||| |
|
|
| T |
33708375 |
agagaaagagaaaatgttacttcgtgcttcattgattcattgatgagtttgaagcgcttaacttgtcttgatttgtc |
33708451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 33714251 - 33714317
Alignment:
| Q |
21 |
aaaatgttacttcatacttcattgattcgttggtgagtttgaaacacttaacccatcttgatttgtc |
87 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| || | |||||| |||||||||||| |
|
|
| T |
33714251 |
aaaatgttactttgtacttcattgattcattggtgagtttaaagcgcttaacttgtcttgatttgtc |
33714317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University