View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-51 (Length: 125)
Name: Solexa-NF5811-51
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-51 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 15 - 125
Target Start/End: Original strand, 32905175 - 32905285
Alignment:
| Q |
15 |
gtttttgtattactatttgatgacttaattatctcaaccttaattagtcctatctttatattgtcttgtctttattaaacaaatacattatcgaatttga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32905175 |
gtttttgtattactatttgatgacttaattatctcaaccttaattagtcctatctttatattgtcttgtctttattaaacaaatacattattgaatttga |
32905274 |
T |
|
| Q |
115 |
tttggttaagg |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
32905275 |
tttggttaagg |
32905285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University