View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-52 (Length: 125)
Name: Solexa-NF5811-52
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-52 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 7 - 125
Target Start/End: Complemental strand, 49954529 - 49954410
Alignment:
| Q |
7 |
atcaaaaacaccaattctctactcaaagatgtcatctctgc-tactccacaaacactgatacaaagattttggaattagggtaagaaaattgaacaaaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49954529 |
atcaaaaacaccaattctctactcaaagatgtcatctttgtataccccacaaacactgatacaaagattttggaattagggtaagaaaattgaacaaaaa |
49954430 |
T |
|
| Q |
106 |
ttgatgggttttatcagaag |
125 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49954429 |
ttgatgggttttatcagaag |
49954410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University