View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-54 (Length: 124)
Name: Solexa-NF5811-54
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 55293933 - 55294037
Alignment:
| Q |
19 |
tatctatctaaatctattagtacaagttacaaaaacggaacatagtttcagtttagtactataagcaaaatatgaaatcatattacaatgttgtttcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55293933 |
tatctatctaaatctattagtacaagttacaaaaacggaacatagtttcagtttagtactataagcaaaatatgaaatcatattacaatgttgtttcttc |
55294032 |
T |
 |
| Q |
119 |
tctct |
123 |
Q |
| |
|
||||| |
|
|
| T |
55294033 |
tctct |
55294037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University