View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-55 (Length: 124)
Name: Solexa-NF5811-55
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 1e-17; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 43539797 - 43539752
Alignment:
| Q |
14 |
ctatgttaactcatgatgtgtcaatcatagggaccaaattgaaagt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43539797 |
ctatgttaactcatgatgtgtcaatcatagggaccaaattgaaagt |
43539752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 79 - 124
Target Start/End: Complemental strand, 43539733 - 43539688
Alignment:
| Q |
79 |
attaatgataaaaaaccaaataaagaatatttatcaccttcatctc |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43539733 |
attaatgataaaaaaccaaaaaaagaatatttatcaccttcatctc |
43539688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 59679 - 59723
Alignment:
| Q |
15 |
tatgttaactcatgatgtgtcaatcatagggaccaaattgaaagt |
59 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
59679 |
tatgttaaccgatgatgtgtcaatcatagggaccaaattgaaagt |
59723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 35676406 - 35676373
Alignment:
| Q |
26 |
atgatgtgtcaatcatagggaccaaattgaaagt |
59 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
35676406 |
atgatgtgtcaatcatagggactaaattgaaagt |
35676373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 60208 - 60168
Alignment:
| Q |
17 |
tgttaactcatgatgtgtcaatcatagggaccaaattgaaa |
57 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
60208 |
tgttaactgctgatgtgtcattcatagggaccaaattgaaa |
60168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 28 - 59
Target Start/End: Original strand, 43539245 - 43539276
Alignment:
| Q |
28 |
gatgtgtcaatcatagggaccaaattgaaagt |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
43539245 |
gatgtgtcaattatagggaccaaattgaaagt |
43539276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 28 - 59
Target Start/End: Complemental strand, 8484189 - 8484158
Alignment:
| Q |
28 |
gatgtgtcaatcatagggaccaaattgaaagt |
59 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
8484189 |
gatgtgtcaatcatagggactaaattgaaagt |
8484158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University