View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-57 (Length: 122)
Name: Solexa-NF5811-57
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-57 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0032 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 45913 - 45792
Alignment:
| Q |
1 |
gaaagattcaattaagtaaagtcaggaatcgaagtggaaaacctgcgattataagaaggcggcgccttaaacgatgattcgacatagattttccttaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45913 |
gaaagattcaattaagtaaagtcaggaatcgaagtggaaaacctgcgattataagaaggcgacgccttaaacgatgattcgacatagattttccttaagt |
45814 |
T |
|
| Q |
101 |
ctttacagcttatctataacat |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45813 |
ctttacagcttatctataacat |
45792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University