View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-58 (Length: 122)
Name: Solexa-NF5811-58
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-58 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 10379174 - 10379289
Alignment:
| Q |
7 |
aggtccatgttctctgttgctagcataaatgatggaataatcattgttggaggaaaatcaaatattggcaaagtagtaggtccaattaaagaacacaatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10379174 |
aggtccatgttctctgttgctagcataaatgatggaataatcattgttggaggaaaatcaaatattggcaaagtagtaggtccaattaaagaacacaatg |
10379273 |
T |
|
| Q |
107 |
aggttgttttttctag |
122 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10379274 |
aggttgttttttctag |
10379289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 21 - 118
Target Start/End: Original strand, 10367505 - 10367602
Alignment:
| Q |
21 |
tgttgctagcataaatgatggaataatcattgttggaggaaaatcaaatattggcaaagtagtaggtccaattaaagaacacaatgaggttgtttttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10367505 |
tgttgctagcataaatgatggaataatcattgttggaggaaaatcaaatattggcaaagtagtaggtccaattaaagaacacaatgaggttgtttttt |
10367602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University