View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-60 (Length: 120)
Name: Solexa-NF5811-60
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-60 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 14 - 120
Target Start/End: Complemental strand, 32905947 - 32905841
Alignment:
| Q |
14 |
gcagtgagaaaacaacagtatgaatcagacatgataggaaggatgattagaatcagcttattatcttctacaaaccacaaggtttttatagaaaactatt |
113 |
Q |
| |
|
|||| |||||| | |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| | | |||||| |
|
|
| T |
32905947 |
gcagagagaaagctacagaatgaatcagacatgatgggaaggatgattagaatcagcttattatcttctacaaaacacaaggtttttattgtatactatt |
32905848 |
T |
|
| Q |
114 |
tcacatt |
120 |
Q |
| |
|
||||||| |
|
|
| T |
32905847 |
tcacatt |
32905841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University