View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-61 (Length: 120)
Name: Solexa-NF5811-61
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-61 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0032 (Bit Score: 106; Significance: 1e-54; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 106; E-Value: 1e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 45201 - 45320
Alignment:
| Q |
1 |
tatcgtgaattagtgttatagatggtccactttggatcacatttggttktctttttagaggtttgkatcacakttgatatgtgttaaatttagagaaatc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
45201 |
tatcgcgaattagtgttatagatggtccactttggatcacatttggttttctttttagaggtttggatcacatttgatatgtgttaaatttagagaaatc |
45300 |
T |
|
| Q |
101 |
ataattgtatagccatattt |
120 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
45301 |
ataattgtataaccatattt |
45320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University