View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-64 (Length: 120)
Name: Solexa-NF5811-64
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-64 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 24689076 - 24688964
Alignment:
| Q |
8 |
aaactaatagtaccgactgggaatagttcacggttgttatggttgcgtcccatgtggatgcccaaattagacaccacgtctaagagaggtgtgaaagaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24689076 |
aaactaatagtaccgactgggaatagttcacggttgttatggttgcgtcccatgtggatgcccaaattagacaccacgtctaagagaggtgtgaaagaat |
24688977 |
T |
|
| Q |
108 |
aaatgcaattcag |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24688976 |
aaatgcaattcag |
24688964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University