View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-65 (Length: 120)
Name: Solexa-NF5811-65
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 8 - 116
Target Start/End: Original strand, 7077439 - 7077547
Alignment:
| Q |
8 |
tctttcattaatcgtcttatgatgaagaatcgatatataacgtttctcatatttatatgcaagcaaacccagtagcagactggcttgcgggctatgtcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7077439 |
tctttcattaatcgtcttatgatgaaggaccgatatataacgtttctcataattatatgcaagcaaacccagtagcagattggcttgcgggctatgtcat |
7077538 |
T |
|
| Q |
108 |
tcagcacct |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
7077539 |
tcagcacct |
7077547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University