View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5811-65 (Length: 120)

Name: Solexa-NF5811-65
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5811-65
Solexa-NF5811-65
[»] chr2 (1 HSPs)
chr2 (8-116)||(7077439-7077547)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 8 - 116
Target Start/End: Original strand, 7077439 - 7077547
Alignment:
8 tctttcattaatcgtcttatgatgaagaatcgatatataacgtttctcatatttatatgcaagcaaacccagtagcagactggcttgcgggctatgtcat 107  Q
    ||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||    
7077439 tctttcattaatcgtcttatgatgaaggaccgatatataacgtttctcataattatatgcaagcaaacccagtagcagattggcttgcgggctatgtcat 7077538  T
108 tcagcacct 116  Q
    |||||||||    
7077539 tcagcacct 7077547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University