View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-69 (Length: 115)
Name: Solexa-NF5811-69
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-69 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 18669450 - 18669564
Alignment:
| Q |
1 |
gagattggttggcctatgttttatcttagattgattttaaggattatataagtatttatgtttaaatttggagtattcaatcttgatctaatggtcacct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18669450 |
gagattggttggcctatgttttattttagattaattttaaggattatataagtatttatgtttaaatttggagtattcgatcttgatctaatggtcacct |
18669549 |
T |
|
| Q |
101 |
gtgtcatgattgcgt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
18669550 |
gtgtcatgattgcgt |
18669564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 45 - 115
Target Start/End: Complemental strand, 13115944 - 13115874
Alignment:
| Q |
45 |
tatataagtatttatgtttaaatttggagtattcaatcttgatctaatggtcacctgtgtcatgattgcgt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13115944 |
tatataagtatctatgtttaaatttggaatattcaatcttgatctaaaggtcacctgtgtcatgattgcgt |
13115874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University