View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-7 (Length: 207)
Name: Solexa-NF5811-7
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 27646742 - 27646925
Alignment:
| Q |
6 |
cataggtggttgtggttatctcacaaaaagaagagacatgatcatctccaatgctagaactataattgggtttatagcattatttcagttggtatataaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
27646742 |
cataggtggttgtggttatctcacaaaaagaagagacatgatcatctccaatgctagaactataattgggtttttagcattatttcagttgg--tataaa |
27646839 |
T |
 |
| Q |
106 |
tacacttaacattcactcattttattactccaatacactgctacaattcactattttatctatcccactataaaaactcgtcagat |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27646840 |
tacacttaacattcactcgttttattactccaatacactgctacaattcactattttatctatcccactataaaaactcgtcagat |
27646925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University