View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-70 (Length: 111)
Name: Solexa-NF5811-70
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-70 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 29395217 - 29395320
Alignment:
| Q |
8 |
caactttcatggattcagtgtcacaaaaaacaacctccaacagcatcctttgatccttctctctcttcaactttctctatcctcccttgtactcaccctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395217 |
caactttcatggattcagtgtcacaaaaaacaacctccaacagcatcctttgatccttctctctcttcaactttctctatcctcccttgtactcaccctc |
29395316 |
T |
|
| Q |
108 |
tctg |
111 |
Q |
| |
|
|||| |
|
|
| T |
29395317 |
tctg |
29395320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University