View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-73 (Length: 106)
Name: Solexa-NF5811-73
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 12874189 - 12874293
Alignment:
| Q |
1 |
cagatagaaaagcttttaagtcaattggtggaacttgaagttttggtggtgtaagacatggtttctcatgctcaggccatatgaactctgagggtatgtt |
100 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12874189 |
cagagagaaaggcttttaagtcaattggtggaacttgaagttttggtggtgtaagacatggtttttcatgctcaggccatatgaactctgagggtatgtt |
12874288 |
T |
 |
| Q |
101 |
agtaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
12874289 |
agtaa |
12874293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University