View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-76 (Length: 101)
Name: Solexa-NF5811-76
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-76 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 25 - 101
Target Start/End: Original strand, 10457747 - 10457823
Alignment:
| Q |
25 |
ttttgtttctctcttatttctccaccaccaccttctaagagaagtttttgtgtgtcaatactacctaactcaaccac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10457747 |
ttttgtttctctcttatttctccaccaccaccttctaagagaagtttttgtgtgtcaatactacctaactcaaccac |
10457823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University