View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-83 (Length: 86)
Name: Solexa-NF5811-83
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-83 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 8e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 4 - 86
Target Start/End: Complemental strand, 33028870 - 33028781
Alignment:
| Q |
4 |
agttcctatagtagacatttgctaatggaaacataactgat-------gtatccttatacaatcagctttggaggataaagtgcacacgg |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
33028870 |
agttcctatagtagacatttgctaatggaaacataactgatgtatgatgtatccttatacaatcagatttggaggataaagtgcaaacgg |
33028781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University