View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-84 (Length: 85)
Name: Solexa-NF5811-84
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-84 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 48466415 - 48466492
Alignment:
| Q |
8 |
ctttctacagtttccacatttctatgatactgatttccactcacagcaagcaaatcttgaatcaccaattcactacat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48466415 |
ctttctacagtttccacatttctatgatactgagttccactcacagcaagcaaatcttgaatcaccaattcactacat |
48466492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 8 - 61
Target Start/End: Original strand, 42077188 - 42077241
Alignment:
| Q |
8 |
ctttctacagtttccacatttctatgatactgatttccactcacagcaagcaaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
42077188 |
ctttctacagtttccacatttctatgatacttatttccactcacaacaagcaaa |
42077241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University