View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5811-9 (Length: 188)
Name: Solexa-NF5811-9
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5811-9 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 7e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 7e-57
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 32351991 - 32351810
Alignment:
| Q |
1 |
tcaaaacaagtcttagtgttgttgttttagattgatcgccatggagagaagaagttgcgcctttcaaaacaagtcttagtgttgttgttttagatttagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || | ||| || |||||||| |
|
|
| T |
32351991 |
tcaaaacaagtcttagtgttgttgttttagattgatcgccatggagagaagaagttgcgcctttcaatagaaat--tag----gtaaaggaggatttagg |
32351898 |
T |
|
| Q |
101 |
gttgtgtacaatataagcttacgtgatagttatcaaatagaggtgaaaataataaatgattcaaagggagatggaaaagatttcataa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32351897 |
gttgtgtacaatataagcttacgtgatagtcatcaagtagaggtgaaaataataaatgattcaaagggagatggaaaagatttcataa |
32351810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 143 - 188
Target Start/End: Complemental strand, 31574298 - 31574253
Alignment:
| Q |
143 |
gtgaaaataataaatgattcaaagggagatggaaaagatttcataa |
188 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||| |||||||||||| |
|
|
| T |
31574298 |
gtgaaaataataaatgattgaaaggaagaaggacaagatttcataa |
31574253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University