View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5812-1 (Length: 218)
Name: Solexa-NF5812-1
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5812-1 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 78 - 218
Target Start/End: Original strand, 4246757 - 4246897
Alignment:
| Q |
78 |
acttggtttggtaagactcatcgaatgtatttatgattannnnnnncacccacactagctaagcaaatgataaaatcaatttgaaagatatgtattaaaa |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4246757 |
acttggtttggtaagacttatcgaatgtatttatgattatttttttcacccacactagctaagcaaatgataagatcaatttgaaagatatgtattaaaa |
4246856 |
T |
|
| Q |
178 |
agaataggtaatgtctattaaagtctggtcacatgtctaag |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4246857 |
aggataggtaatgtctattaaagtctggtcacatgtctaag |
4246897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 4246703 - 4246757
Alignment:
| Q |
1 |
gagtttcatcaaattggtgatcatataaatattttatgttaatatggataaaatta |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4246703 |
gagtttcatcaaattggtgatcatataaata-tttatgttaatatggataaaatta |
4246757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University