View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5812-14 (Length: 121)
Name: Solexa-NF5812-14
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5812-14 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 4e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 2993204 - 2993095
Alignment:
| Q |
12 |
gaaataaattaagatgcatatggacttcagtcgaagaaagatgacaactcctgttgaaattggttgcaaccatgccattagaaacagaaggtgtcatctc |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2993204 |
gaaacaaattaagatgcatatggacttcagtcgaagaaagatgacaactcctgttaaaattggttgcaaccatgccattagaaacagaaggtgtcatctc |
2993105 |
T |
|
| Q |
112 |
tcctgcgact |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
2993104 |
tcctgcgact |
2993095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 24 - 121
Target Start/End: Original strand, 2928731 - 2928829
Alignment:
| Q |
24 |
gatgcatatggacttcagtcgaagaaagatgacaactcctgttgaaattggt-tgcaaccatgccattagaaacagaaggtgtcatctctcctgcgact |
121 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| ||||| |||||| | | || |||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
2928731 |
gatgcatatgaacttcagtcaaagaaagatgacaacttctgttaaaattgctataaaatcatgtcattagtaatagaaggtgtcatctctcctgcgact |
2928829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 3001356 - 3001300
Alignment:
| Q |
20 |
ttaagatgcatatggacttcagtcgaagaaagatgacaactcctgttgaaattggtt |
76 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| || || ||||||||| |
|
|
| T |
3001356 |
ttaagatgcatatggactacagtccaagaaagatgacaactactattaaaattggtt |
3001300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University