View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5812-16 (Length: 117)
Name: Solexa-NF5812-16
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5812-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 9e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 9e-40
Query Start/End: Original strand, 3 - 117
Target Start/End: Original strand, 4247170 - 4247279
Alignment:
| Q |
3 |
atgagagagtgtatatgaaatataatgtcaaccttccattccaatacagagaggaataaacaaatcttattttgaaattggaattttatgtcaaataacc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4247170 |
atgagagagtgtatatgaaatataatgtcaaccttgca-----atacagagaggaataaacaaatcttattttgaaattggaattttatgtcaaatcacc |
4247264 |
T |
|
| Q |
103 |
aaataataatcataa |
117 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
4247265 |
aaataataataataa |
4247279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University