View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5812-2 (Length: 178)
Name: Solexa-NF5812-2
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5812-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 9e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 9e-38
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 14272808 - 14272705
Alignment:
| Q |
1 |
gatcacaagccccaaagacttcttcaaacaattcatcgttgagtcgaagaagctgtggtacattgttgtgtctgccatcttcttcttcgtctctaaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | |||||||||||| ||||||||| |||||| |
|
|
| T |
14272808 |
gatcacaagccccaaagacttcttcaaacaattcatcgttgagtcgaagaagctgtggtaccttgctgggcctgccatcttctccttcgtctccaaatat |
14272709 |
T |
|
| Q |
101 |
tccc |
104 |
Q |
| |
|
|||| |
|
|
| T |
14272708 |
tccc |
14272705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 163
Target Start/End: Original strand, 6139989 - 6140035
Alignment:
| Q |
117 |
aacatgtaaatctactttttgagataaatcaaatagtatgccttcaa |
163 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
6139989 |
aacatgtatatctactttttgagacaaatcaaatattattccttcaa |
6140035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 117 - 163
Target Start/End: Original strand, 6186836 - 6186882
Alignment:
| Q |
117 |
aacatgtaaatctactttttgagataaatcaaatagtatgccttcaa |
163 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
6186836 |
aacatgtatatctactttttgagacaaatcaaatattattccttcaa |
6186882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University