View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-1 (Length: 255)
Name: Solexa-NF5813-1
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-1 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 36423532 - 36423285
Alignment:
| Q |
8 |
cccatttcaccaaatgtccatcaactgtaaagcttggaccttttggttgttccaaggaaattggatttatcaagttcaactctccgttgagtttctgaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423532 |
cccatttcaccaaatgtccatcaactgtaaagcttggaccttttggttgttccaaggaaattggatttatcaagttcaactctccgttgagtttctgaac |
36423433 |
T |
 |
| Q |
108 |
tgagtaacggtaatcagtgtcgataccatttgcgacaggaatgtttagtccattatctgtaatggacacaacctctctcttatccatatcaaccaacaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423432 |
tgagtaacggtaatcagtgtcgataccatttgcgacaggaatgtttagtccattatctgtaatggacacaacctctctcttatccatatcaaccaacaca |
36423333 |
T |
 |
| Q |
208 |
gttaaaccttctatcggtttcatgtagaaattgacagtgcctttgctt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423332 |
gttaaaccttctatcggtttcatgtagaaattgacagtgcctttgctt |
36423285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University