View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-10 (Length: 160)
Name: Solexa-NF5813-10
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 9e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 9e-53
Query Start/End: Original strand, 7 - 159
Target Start/End: Original strand, 29598260 - 29598412
Alignment:
| Q |
7 |
aagaactgcaacttatccccactcaaaagacttagcctctgtttggatatgcagtagaggcacgattttcgcgtccggagacaaaattcaacgtgatatt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| | |||||| |||||| || ||| ||| ||||||||||||||||||| |
|
|
| T |
29598260 |
aagaactgccacttatccccactcaaaagacttagcctctgtttggatgtgcactggaggcatgatttttgcatcccgaggcaaaattcaacgtgatatt |
29598359 |
T |
|
| Q |
107 |
ctgaagctagtatttgggcttctcaataaacgcacgtctattctcttaccaac |
159 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29598360 |
gtgaagatagtatttaggcttctcaataaacgcacgtctattctcttaccaac |
29598412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 72 - 143
Target Start/End: Original strand, 27912803 - 27912875
Alignment:
| Q |
72 |
ttttcgcgtccggagacaaaattcaacgtgatattctgaagctagtatttg-ggcttctcaataaacgcacgt |
143 |
Q |
| |
|
|||||||||| ||| ||||| | |||||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
27912803 |
ttttcgcgtcatgaggcaaaagtggacgtgatattgtgaagctagtatttgtggcttctcaataaacacacgt |
27912875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 63 - 121
Target Start/End: Complemental strand, 29555633 - 29555575
Alignment:
| Q |
63 |
gaggcacgattttcgcgtccggagacaaaattcaacgtgatattctgaagctagtattt |
121 |
Q |
| |
|
|||||| ||||||||||||| || || ||||||||||||||| |||||||||||||| |
|
|
| T |
29555633 |
gaggcaagattttcgcgtcccgaagcaggattcaacgtgatattgtgaagctagtattt |
29555575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University