View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-12 (Length: 156)
Name: Solexa-NF5813-12
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 10689225 - 10689092
Alignment:
| Q |
8 |
atcccaagggagaagaaactttgaggcaagttttgtgactgaaccactctcaattggcctcaatgtcgctttgaaatcaatttgtgataattcctttggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10689225 |
atcccaagggagaagaaactttgaggcaagttttgtgactgaaccactctcaattggcctcaatgttgctttgaaatcaatttgtgataattcctttggt |
10689126 |
T |
|
| Q |
108 |
attccaggagcagcagttatgtcttctctatgtt |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
10689125 |
attccaaaagcagcagttatgtcttctctatgtt |
10689092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University