View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-13 (Length: 143)
Name: Solexa-NF5813-13
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 9e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 8 - 143
Target Start/End: Original strand, 35908836 - 35908971
Alignment:
| Q |
8 |
ataatgactcctcatctagttcatagatcacaatttactcttaatttagttagttgcaaacatttgcttgctatccaagtaaacttcatttttagatcat |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35908836 |
ataatgacaactcatctagttcatagatcacaatttactcttaatttagttagttgcaaacatttgcttgttatccaagtaaacttcatttttagatcat |
35908935 |
T |
|
| Q |
108 |
caatacaatacatgagttttctctctcaatttcctt |
143 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35908936 |
caatacaatacatgcgttttctctctcaatttcctt |
35908971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 89 - 138
Target Start/End: Original strand, 35910806 - 35910855
Alignment:
| Q |
89 |
aacttcatttttagatcatcaatacaatacatgagttttctctctcaatt |
138 |
Q |
| |
|
||||||||||||| ||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
35910806 |
aacttcatttttaaatcatcaattccataaatgagttttctctctcaatt |
35910855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University