View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-22 (Length: 130)
Name: Solexa-NF5813-22
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-22 |
 |  |
|
| [»] scaffold0300 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0300 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 3770 - 3897
Alignment:
| Q |
1 |
gacaccagatcaatctctaaaatgaaaatatcttaaaagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3770 |
gacaccagatcaatctctaaaatgaacatatcttaagagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacctt |
3869 |
T |
 |
| Q |
101 |
caattttgacggtcttcaattatgaacc |
128 |
Q |
| |
|
| |||||||||||||||| ||||||||| |
|
|
| T |
3870 |
cgattttgacggtcttcagttatgaacc |
3897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University