View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-23 (Length: 128)
Name: Solexa-NF5813-23
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 28932274 - 28932386
Alignment:
| Q |
8 |
gtgattaatgtccacacacaacaannnnnnngaattggatttagttttgcatcaagttgagatattgcttgtatatattttaagatactaataacacatc |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28932274 |
gtgattaatgtccacacacaacaatttttttgaattggatttagttttgcatcaagttgagatattgcttgtatatattttaagatactaataacacatc |
28932373 |
T |
 |
| Q |
108 |
tgtaccctatgct |
120 |
Q |
| |
|
| |||||| |||| |
|
|
| T |
28932374 |
tataccctttgct |
28932386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University