View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-24 (Length: 127)
Name: Solexa-NF5813-24
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-24 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 7e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 2288656 - 2288775
Alignment:
| Q |
10 |
aactggaattatgatatatcctta--atttgttaattgccaattttagtttcttctctttctgtattcgtatttacacggccacagccaccataacttgc |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288656 |
aactggaattatgatatatccttataatttgttaattgccaattttaatttcttctctttctgtattcgtatttacacggccacagccaccataacttgc |
2288755 |
T |
|
| Q |
108 |
attgttgatttaaggaaaca |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2288756 |
attgttgatttaaggaaaca |
2288775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 94 - 127
Target Start/End: Complemental strand, 2255780 - 2255747
Alignment:
| Q |
94 |
ccaccataacttgcattgttgatttaaggaaaca |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
2255780 |
ccaccataacttgcattgttggtttaaggaaaca |
2255747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University