View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-26 (Length: 124)
Name: Solexa-NF5813-26
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 5295315 - 5295201
Alignment:
| Q |
8 |
cattcaactcagtttttcaagaaatcaaagagtttcattctctcccaattcatgagttcttcattgatgtttatgtgataaaacgtgagaattttgtttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295315 |
cattcaactcagtttttcaagaaatcaaagagtttcattctctcccaattcatgagttcttcattgatgtttatgtgataaaacgtgagaattttgtttc |
5295216 |
T |
|
| Q |
108 |
actttttaataaatt |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5295215 |
actttttaataaatt |
5295201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University