View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-30 (Length: 120)
Name: Solexa-NF5813-30
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 18237201 - 18237310
Alignment:
| Q |
8 |
acctaaacaaagcaataaagttgatttgagttggaattcaaccgcaacactaaaatcattatccagaacaagcaacccctcagtaacccacaccttcctc |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18237201 |
acctaaacaaagcaataaggttgatttgagttggaattcaaccgcagtactaaaatcattatccaaaacaagcaacccctcagtaacccacaccttcctc |
18237300 |
T |
 |
| Q |
108 |
ttctggcttc |
117 |
Q |
| |
|
||| |||||| |
|
|
| T |
18237301 |
ttccggcttc |
18237310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University