View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-31 (Length: 120)
Name: Solexa-NF5813-31
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 30174546 - 30174445
Alignment:
| Q |
8 |
caatgaagccttaggttttgttggcctagttgagtacactataggcaatggttccaaaattttatcacattttccattccatttagcttgcatatacctt |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30174546 |
caatgaagccttaggttttgttgacctagtggagtacactataggcaatggttccaaaattttatcacattttccattccatttagcttgcatatacttt |
30174447 |
T |
|
| Q |
108 |
tg |
109 |
Q |
| |
|
|| |
|
|
| T |
30174446 |
tg |
30174445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University