View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-34 (Length: 100)
Name: Solexa-NF5813-34
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-34 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 10688144 - 10688243
Alignment:
| Q |
1 |
gagttgatcaaggatctatgaatatgggaaatggccaaatcaagaacctcagttcaagttctttggaaattgccaatccctcaacagttgcacaattatt |
100 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10688144 |
gagttgatcaagcatctatgaatattggaaattgccaaatcaagaacctcagttcaagttctttggaaattgccaatcccacaacacttgcacaattatt |
10688243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 1e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 5444855 - 5444955
Alignment:
| Q |
1 |
gagttgatcaaggatctatgaatatgggaaatggccaaatcaag-aacctcagttcaagttctttggaaattgccaatccctcaacagttgcacaattat |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
5444855 |
gagttgatcaaggatcaatgaatatgggaaattgccaaatccctcaacctcagtccaagttctttggaaattgccaatccctcaacacttgcccaattat |
5444954 |
T |
|
| Q |
100 |
t |
100 |
Q |
| |
|
| |
|
|
| T |
5444955 |
t |
5444955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University