View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-38 (Length: 85)
Name: Solexa-NF5813-38
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 18238194 - 18238125
Alignment:
| Q |
1 |
gaacggtgaatgtgctgcggctagtgtgcatccacaacctattgctgacccaatatggaggtaagaatga |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18238194 |
gaacggtgaatgtgctgcggctagtgtgcatccacaacctattgctgacccaatatggaggtaagaatga |
18238125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University