View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-41 (Length: 76)
Name: Solexa-NF5813-41
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-41 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 46649695 - 46649620
Alignment:
| Q |
1 |
gacagatcgagaccatgaatgataatttgtgccattcaacaaaggagtagcaagaatgagactgggattctcattg |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46649695 |
gacagatcgagaccatgaatgataatttgtgccattcaacaaaggagtagcaagaatgagactgggattttcattg |
46649620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University