View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-44 (Length: 52)
Name: Solexa-NF5813-44
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-19
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 28933860 - 28933809
Alignment:
| Q |
1 |
cccaacactaacgaatgtggttacattcaattatttcatattctaaaattat |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28933860 |
cccaacactgacgaatgtggttacattcaattatttcatattctaaaattat |
28933809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.00000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 39828513 - 39828476
Alignment:
| Q |
15 |
atgtggttacattcaattatttcatattctaaaattat |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39828513 |
atgtggttacattcaattatttcatattctcaaattat |
39828476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University