View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-5 (Length: 190)
Name: Solexa-NF5813-5
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 190
Target Start/End: Original strand, 31439059 - 31439241
Alignment:
| Q |
8 |
ctcatttctcaccgattttagctgttcaggttacttccctcgccgatggaatcttcatcggcatcgctgtctcccatgccgtcaccgacggttccacctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439059 |
ctcatttctcaccgattttagctgttcaggtaacttccctcgccgatggaatcttcatcggcatcgctgtctcccatgccgtcaccgacggttccacctt |
31439158 |
T |
 |
| Q |
108 |
ctggaatttcttcaacacgtttgcagacatttctagaggactcacagacgctaacagaatcccggatttccgccgggaatcga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
31439159 |
ctggaatttcttcaacacgtttgcagacatttctagaggactcacagtcgctaacagaatcccgtatttccgccgggaatcga |
31439241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University