View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5813-7 (Length: 176)
Name: Solexa-NF5813-7
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5813-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 6e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 6e-74
Query Start/End: Original strand, 13 - 174
Target Start/End: Complemental strand, 8441386 - 8441225
Alignment:
| Q |
13 |
catcattgagatcacttgtaattgtggtgaaaacgcgactgcagtaagatagaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataa |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8441386 |
catcattgagatcacttgtagttgtggtcaaaacgcgactgcagtaagataaaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataa |
8441287 |
T |
|
| Q |
113 |
aacagtgttggttagagattgtgtgtgccmctctacgggctgatccaagcataaaactgtgt |
174 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8441286 |
aaaggtgttggttagagattgtgtgtgcccctctacgggctgatccaagcataaaactgtgt |
8441225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University